The granulocyte colony-stimulating factor receptor supports erythroid differentiation in the absence of the erythropoietin receptor or Stat5.

To evaluate the functional conservation of signal transduction mechanisms between haematopoietic receptors and to characterize the molecules activated in this phenomenon, we introduced granulocyte colony-stimulating factor receptor (G-CSFR) cDNA into mouse fetal liver cells using a retroviral vector. In semi-solid medium assays, G-CSFR-infected cells gave rise to all types of colonies [granulocyte-macrophage (GM), megakaryocyte (MK) and mixed lineage (GEMM) colony-forming units (CFU) and erythroid burst-forming units (BFU-E)] in the presence of G-CSF alone. The direct effect of G-CSF on erythroid differentiation of G-CSFR-transduced erythroid progenitors was demonstrated by the development of erythroid colonies using G-CSFR-expressing Lin- cells cloned at one cell per well in liquid culture in the presence of G-CSF. Interestingly, while Stat5, but not Stat3, was activated in erythroid cells in response to erythropoietin (EPO), both were activated in erythroid and granulocytic cells stimulated by G-CSF. Furthermore, G-CSF induced the growth of erythroid colonies from G-CSFR-expressing fetal liver cells from EPO receptor-/- (EPO-R-/-) or Stat5a-/- Stat5b-/- mice, demonstrating that erythroid differentiation can occur in the absence of EPO-R or Stat5. These data show that forced expression of G-CSFR allows G-CSF-dependent multilineage proliferation and differentiation of haematopoietic progenitors and rescues EPO-R-/- erythroid cells. While G-CSF induces Stat5 activation in G-CSFR-expressing erythroid cells, this activation is not necessary for the terminal erythroid differentiation induced by G-CSF.

Gene activation by triplex-forming oligonucleotide coupled to the activating domain of protein VP16.

Triplex-forming oligonucleotides (TFOs) are generally designed to inhibit transcription or DNA replication but can be used for more diverse purposes. Here we have designed a chimera peptide-TFO able to activate transcription from a target gene. The designed hybrid molecule contains a triplex-forming sequence, linked through a phosphoroamidate bond to several minimal transcriptional activation domains derived from Herpes simplex virus protein 16 (VP16). We show here that this TFO-peptide chimera (TFO-P) can specifically recognise its DNA target at physiological salt and pH conditions. Bound to the double-stranded target DNA in a promoter region, the TFO-P is able to activate gene expression. Our results suggest that this type of molecule may prove useful in the design of new tools for artificial modulation of gene expression.

Stability of G,A triple helices.

In this work we selected double-stranded DNA sequences capable of forming stable triplexes at 20 or 50 degrees C with corresponding 13mer purine oligonucleotides. This selection was obtained by a double aptamer approach where both the starting sequences of the oligonucleotides and the target DNA duplex were random. The results of selection were confirmed by a cold exchange method and the influence of the position of a 'mismatch' on the stability of the triplex was documented in several cases. The selected sequences obey two rules: (i) they have a high G content; (ii) for a given G content the stability of the resulting triplex is higher if the G residues lie in stretches. The computer simulation of the Mg2+, Na+and Cl-environment around three triplexes by a density scaled Monte Carlo method provides an interpretation of the experimental observations. The Mg2+cations are statistically close to the G N7 and relatively far from the A N7. The presence of an A repels the Mg2+from adjacent G residues. Therefore, the triplexes are stabilized when the Mg2+can form a continuous spine on G N7.

Analysis of various sequence-specific triplexes by electron and atomic force microscopies.

Sequence-specific interactions of 20-mer G,A-containing triple helix-forming oligonucleotides (TFOs) and bis-PNAs (peptide nucleic acids) with double-stranded DNA was visualized by electron (EM) and atomic force (AFM) microscopies. Triplexes formed by biotinylated TFOs are easily detected by both EM and AFM in which streptavidin is a marker. AFM images of the unlabeled triplex within a long plasmid DNA show a approximately 0.4-nm height increment of the double helix within the target site position. TFOs conjugated to a 74-nt-long oligonucleotide forming a 33-bp-long hairpin form extremely stable triplexes with the target site that are readily imaged by both EM and AFM as protruding DNA. The short duplex protrudes in a perpendicular direction relative to the double helix axis, either in the plane of the support or out of it. In the latter case, the apparent height of the protrusion is approximately 1.5 nm, when that of the triplex site is increased by 0.3-0.4 nm. Triplex formation by bis-PNA, in which two decamers of PNA are connected via a flexible linker, causes deformations of the double helix at the target site, which is readily detected as kinks by both EM and AFM. Moreover, AFM shows that these kinks are often accompanied by an increase in the DNA apparent height of approximately 35%. This work shows the first direct visualization of sequence-specific interaction of TFOs and PNAs, with their target sequences within long plasmid DNAs, through the measurements of the apparent height of the DNA double helix by AFM.

Recruitment of transcription factors to the target site by triplex-forming oligonucleotides.

Triplex-forming oligonucleotides (TFOs) are generally designed to inhibit transcription or DNA replication but can be used for more diverse purposes. Here we have designed a hairpin-TFO able to recruit transcription factors to a target DNA. The designed oligonucleotide contains a triplex-forming sequence, linked through a nucleotide loop to a double-stranded hairpin including the SRE enhancer of the c-fos gene promoter. We show here that this oligonucleotide can specifically recognise its DNA target at physiological salt and pH conditions. The stability of the triplex formed under these conditions is very high: >90% of the triplex remains intact after 24 h of incubation. Bound to the double-stranded target DNA, the oligonucleotide retains its ability to interact specifically with transcription factors, recruiting them to the proximity of the target DNA. Our results suggest that this type of oligonucleotide may prove useful in the design of new tools for artificial modulation of gene expression.

Investigation of the formation and intracellular stability of purine.(purine/pyrimidine) triplexes.

In a previous work we showed that a short triple helix-forming oligonucleotide (TFO) targeted to the murine c-pim-1 proto-oncogene promoter gives a very stable triple helix under physiological conditions in vitro . Moreover, this triplex was stable inside cells when preformed in vitro . However, we failed to detect triplex formation for this sequence inside cells in DMS footprinting studies. In the present work, in order to determine whether our previous in vivo results are limited to this particular short triplex or can be generalized to other purine.(purine/pyrimidine) triplexes, we have tested three other DNA targets already described in the literature. All these purine.(purine/pyrimidine) triplexes are specific and stable at high temperature in vitro . In vivo studies have shown that the preformed triplexes are stable inside cells for at least 3 days. This clearly demonstrates that intracellular conditions are favourable for the existence of purine. (purine/pyrimidine) triplexes. The triplexes can also be formed in nuclei. However, for all the sequences tested, we were unable to detect any triple helix formation in vivo in intact cells by DMS footprinting. Our results show that neither (i) chromatinization of the DNA target, (ii) intracellular K+concentration nor (iii) cytoplasmic versus nuclear separation of the TFO and DNA target are responsible for the intracellular arrest of triplex formation. We suggest the existence of a cellular mechanism, based on a compartmentalization of TFOs and/or TFO trapping, which separates oligonucleotides from the DNA target. Further work is needed to find oligonucleotide derivatives and means for their delivery to overcome the problem of triplex formation inside cells.

A new approach to overcome potassium-mediated inhibition of triplex formation.

G,A-containing purine oligonucleotides of various lengths form extremely stable and specific triplexes with the purine-pyrimidine stretch of the vpx gene [Svinarchuk,F., Monnot,M., Merle,A., Malvy,C. and Fermandjian,S. (1995) Nucleic Acids Res., 22, 3742--3747]. The potential application of triple-helix-forming oligonucleotides (TFO) in gene-targeted therapy has prompted us to study triplex formation mimicking potassium concentrations and temperatures in cells. Triplex formation was tested by dimethyl sulphate (DMS) footprinting, gel-retardation, UV melting studies and electron microscopy. In the presence of 10 mM MgCl2, KCl concentrations up to 150 mM significantly lowered both efficiency (triplex : initial duplex) and rate constants of triplex formation. The KCl effect was more pronounced for 11mer and 20mer TFOs than for 14mer TFO. Since the dissociation half-life for the 11mer TFO decreases from 420 min in the absence of monovalent cations to 40 min in the presence of 150 mM KCI, we suggest that the negative effect could be explained by a decrease in triplex stability. In contrast, for the 20mer TFO no dissociation of the triplex was observed during 24 h of incubation either in the absence of monovalent cations or in the presence of 150 mM KCl. We suppose that in the case of the 20mer TFO the negative effect of KCI on triplex formation is probably due to the self-association of the oligonucleotide in competitive structures such as parallel duplexes and/or tetraplexes. This negative effect may be overcome by the prior formation of a short duplex either on the 3'- or 5'-end of the 20mer TFO. We refer to these partial duplexes as 'zipper' TFOs. It was demonstrated that a 'zipper' TFO can form a triplex over the full length of the target, thus unzipping the short complementary strand. The minimal single-stranded part of the 'zipper' oligonucleotide which is sufficient to initiate triplex formation can be as short as three nucleotides at the 3'-end and six nucleotides at the 5'-end. We suggest that this type of structure may prove useful for in vivo applications.

Investigation of the intracellular stability and formation of a triple helix formed with a short purine oligonucleotide targeted to the murine c-pim-1 proto-oncogene promotor.

In our previous work we have shown that the oligonucleotide 5'-GGGGAGGGGGAGG-3' gives a very stable and specific triplex with the promoter of the murine c-pim-1 proto-oncogene in vitro[Svinarchuk, F., Bertrand, J.-R. and Malvy, C.(1994)Nucleic Acids Res., 22, 3742-3747]. In the present work, we have tested triplex formation with some derivatives of this oligonucleotide which are designed to be degradation-resistant inside the cells, and we show that phosphorothioate and the oligonucleotide with a 3' terminal amino group are still able to form triplexes. Moreover these oligonucleotides, like the 13mer oligonucleotide of similar composition [Svinarchuk, F., Paoletti, J., and Malvy, C. (1995) J. Biol. Chem., 270, 14068-14071], are able to stabilize the targeted duplex. In vivo DMS footprint analysis after electroporation of the pre-formed triplex into the cell have shown the presence of the triple helix inside the cells. This triplex structure partially blocks c-pim-1 promotor activity as shown by transient assay with a c-pim-1 promoter-luciferase gene construct. To our knowledge these data are the first direct evidence that conditions inside cells are favorable for triplex stability with non-modified oligonucleotides. However we were unable to show triplex formation inside living cells using various methods of oligonucleotide delivery. We suppose that this may be due to the oligonucleotide being sequestered by cellular processes or proteins. Further work is needed to find oligonucleotide derivatives and ways of their delivery to overcome the problem of triplex formation inside the cells.

The high stability of the triple helices formed between short purine oligonucleotides and SIV/HIV-2 vpx genes is determined by the targeted DNA structure.

In our previous works we have shown that the oligonucleotides 5'-GGGGAGGGGGAGG-3' and 5'-GGAGGGGGAGGGG-3' give very stable and specific triplexes with their target double stranded DNAs [Svinarchuk, F., Bertrand, J.-R. and Malvy, C. (1994) Nucleic Acids Res., 22, 3742-3747; Svinarchuk, F., Paoletti, J. and Malvy, C. (1995) J. Biol. Chem., 270, 14 068-14,071]. The target for the invariable part of these oligonucleotides, 5'-GGAGGGGGAGG-3', is found in a highly conserved 20 bp long purine/pyrimidine tract of the vpx gene of the SIV and HIV-2 viruses and could be a target for oligonucleotide directed antivirus therapy. Here were report on the ability of four purine oligonucleotides with different lengths (11-, 14-, 17- and 20-mer) to form triplexes with the purine/pyrimidine stretch of the vpx gene. Triplex formation was tested by joint dimethyl sulfate (DMS) footprint, gel-retardation assay, circular dichroism (CD) and UV-melting studies. Dimethyl sulfate footprint studies revealed the antiparallel orientation of the third strand to the purine strand of the Watson-Crick duplex. However, the protection of the guanines at the ends of the target sequence decreased as the length of the third strand oligonucleotide increased. Melting temperature studies provided profiles with only one transition for all of the triplexes. The melting temperatures of the triplexes were found to be the same as for the targeted duplex in the case of the 11- and 14-mer third strands while for the 17- and 20-mer third strands the melting temperature of the triplexes were correspondingly 4 and 8 degrees C higher than for the duplex. Heating and cooling melting curves were reversible for all of the tested triplexes except one with the 20-mer third strand oligonucleotide. Circular dichroism spectra showed the ability of the target DNA to adopt an A-like DNA conformation. Upon triplex formation the A-DNA form becomes even more pronounced. This effect depends on the length of the third strand oligonucleotide: the CD spectrum shows a 'classical' A-DNA shape with the 20-mer. This is not observed with the purine/pyrimidine stretch of the HIV-1 DNA which keeps a B-like spectrum even after triplex formation. We suggest, that an A-like duplex DNA is required for the formation of a stable DNA purine(purine-pyrimidine) triplex.

An unusually stable purine(purine-pyrimidine) short triplex. The third strand stabilizes double-stranded DNA.

Classical models for DNA triple helix formation assume the stabilization of these structures through the formation of Hoogsteen hydrogen bonds. This assumes that G-rich duplex DNA is more stable than triplex DNA. We report the results of co-migration assay, dimethyl sulfate footprint, and UV spectroscopic melting studies that reveal that at least in some cases of short (13-mer) purine(purine-pyrimidine) triplex the stability of double-stranded DNA is increased by the binding of the third strand. Under conditions which are usually considered as physiological (10 mM MgCl2, 150 mM Na+ or K+) and with a rate of heating/cooling of 1 degrees C/min, there is a good reversibility of the melting profiles which is consistent with a high rate of triplex formation. Other factors than Hoogsteen hydrogen bonds should therefore be involved in triplex stabilization. We suggest that oligonucleotides with similar properties could be efficient agents for artificial gene regulation.

[Functional activity of T-, B-lymphocytes, and macrophages during suppression of expression of the env gene from an endogenous retrovirus genome]. / Funktsional'naia aktivnost' T-, B-limfotsitov i makrofagov v usloviiakhpodavleniia ékspressii gena env éndogennogo retrovirusnogo genoma.

Incubation of murine spleen cells with antisense oligonucleotide complementary to initiation site of this gene highly increased RNA synthesis relative to the normal T- and B-lymphocytes from spleen. In macrophages, inhibition of gene env expression stimulated phagocytosis and IL-1 production. Under these conditions, the level of expression of proviral envelope transmembrane p15E protein, which in infectious type C retroviruses is known to be immunosuppressive, decreased in spleen cells. Antisense oligonucleotide stimulatory effect on murine spleen cell RNA synthesis is presumably related to the reduced production of endogenous p15E.

Gene-targeted inhibition of transactivation of human immunodeficiency virus type-1 (HIV-1)-LTR by antisense oligonucleotides.

We have used an in vitro approach to study the efficiency of antisense oligonucleotides in inhibiting LTR-(HIV-1)-directed CAT expression catalyzed by tat protein, the functional protein of the transactivator gene. We selected the target sequence localized near the 5' end of the tat mRNA. The following conclusions can be drawn from the data presented here: a) Antisense oligonucleotides modified by conjugation of cholesterol at the 3' end have a severalfold higher inhibitory response, b) inhibitory response is dependent on the mode of introducing oligonucleotides, and c) the inhibition by antisense oligonucleotides is sequence specific and directed towards the targeted region. This approach could be useful for targeting functional regions of regulatory gene products and designing gene-targeted inhibitors of virus replication.

A short purine oligonucleotide forms a highly stable triple helix with the promoter of the murine c-pim-1 proto-oncogene.

A homopurine-homopyrimidine region of murine c-pim-1 proto-oncogene was chosen as a target for triple-helix-forming oligonucleotide. Oligonucleotide 5'-GGG-GAGGGGGAGG-3' was shown to bind to its target sequence in the presence of 50 mM Na+ or K+, 10 mM MgCl2 and 20 mM Tris-acetate, pH 7.5. This oligonucleotide is bound in an antiparallel orientation with respect to the homopurine sequence. As was shown by co-migration assay the triplex is stable up to 65 degrees C. At 37 degrees C it was practically irreversible: after 24 hours of co-migration assay there was no traces of triplex dissociation. The rate of triplex formation was highly accelerated with increase of temperature and Mg2+ concentration. This rate was higher for superhelical DNA when compared to the linear and circular ones and the preference was dependent from temperature and Mg2+ concentration. The precision of this interaction is extremely high: sequences in c-pim-1 promoter region with only one substitution when compared to the target gave negligible triplex formation under investigated conditions. These data suppose that natural triplex structures could play an important role in eukaryotic gene regulation and/or chromatin structure formation.

Antisense oligonucleotide complementary to endogenous retroviral MCF env gene inhibits both BFU-E and CFU-S colony formation in mice.

A possible biologic activity of endogenously expressed env sequence of retroviral mink cell focus-forming virus (MCF) genome for hematopoietic colony formation was studied in mice. Antisense 20-mer complementary to MCF env sequence was used to detect the result of blockage of this gene translation on the potency of marrow cells to form colonies of erythroid (BFU-E), myeloid granulocyte-macrophage (CFU-GM), and stem cell (day 11 CFU-S) hematopoietic compartments. A large relative decrease in BFU-E number was found in bone marrow cell cultures preincubated with antisense oligonucleotide during 4 h, whereas CFU-GM colonies remained unaffected. A marked reduction of CFU-S colony formation was also registered under antisense oligomer influence. Following a decreased proliferation of erythroid progenitors, we suggest the mechanism by which antisense oligonucleotide could cause the loss of colony formation. Taken together, these data allow to propose that the expression of this gene is naturally significant for hematopoietic progenitor activity exerting some property of env gene products to regulate the growth of erythroid and multilineage hematopoietic precursors.

[Binding of nuclear proteins with segments of the c-fos gene promotor, localized in position (-465)-(-435) correlates with cell proliferation]. / Sviazyvanie iadernykh belkov s uchastkom promotora gena c-fos, lokalizovannym v pozitsii (-464)-(-435), korreliruet s kletochnoi proliferatsiei.

Using gel-retardation assay we have investigated binding of nuclear proteins to the mouse c-fos promoter region 30 b.p. long (nucleotides (-464) - (-435) from TATA-box), localized upstream of PDGF-dependent induction element. It was found that some factors from nuclear extracts of various human and murine cells bind to this promoter region. After gel-retardation of DNA- protein complexes from nuclear extracts of quiescent and stimulated with 20% fetal calf serum cells we observed only one retarded band, while after gel-retardation of DNA-protein complexes from proliferating pseudonormal and tumorigenic cells we observed the appearance of additional retarded band with higher mobility in PAAG. We also have determined the molecular weights of factors interacting with investigated c-fos promoter region by affinity modification method. The molecular weights of both factors are 59 kDa. The equality of molecular weights of investigated factors suggests that these factors might be different forms of one nuclear protein.

[Inhibition of reproduction of the human immunodeficiency virus by sense and antisense oligodeoxynucleotides]. / Ingibirovanie reproduktsii virusa immunodefitsita cheloveka smyslovymi i antismyslovymi oligodezoksinukleotidami.

Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.7 microM) and pTTTTTTTTTTTTTTTT (PA-16) (ID50 = 8.0 microM). A sense oligonucleotide pGCATCAAGCAGCTCCAGGCA (PM-20) (ID50 = 0.5 microM) complementary to the region of the start of translation of the open reading frame on the (+)-chain virus DNA was also investigated. Specificity of the anti-HIV-I action of oligonucleotides was confirmed by experiments with HIV-II.

[Nuclear peptides, specifically binding oligonucleotides]. / Iadernye peptidy, spetsifichno sviazyvaiushchie oligonukleotidy.

Interaction of alkylating derivatives of oligonucleotides with nuclear extracts from mammalian cells has been investigated. Three modified 1.5-, 3.0-, and 6.0-kDa proteins were detected in nuclear extracts from human and murine cells. The 1.5-kDa and 3.0-kDa proteins were also detected in insect, plant, yeast, and bacterial cells. The ubiquity of the proteins suggests their important role in cellular metabolism.

Inhibition of HIV proliferation in MT-4 cells by antisense oligonucleotide conjugated to lipophilic groups.

Anti-HIV activity of antisense oligonucleotide derivatives conjugated to lipophilic groups has been investigated. Aliphatic linear structures and cholesterol were coupled to the 5'-terminal phosphate of oligonucleotides via glycine or propylene diamine spacers. The oligonucleotides were targeted to a conserved sequence of the viral gene env, to a sequence in the negative sense viral RNA, to the 5'-terminus of the gene rev and to poly(A) sequences. The conjugation with lipophilic groups stimulated binding of oligonucleotides to cells and protected the oligonucleotides against cellular nucleases. The lipophilic derivatives of oligonucleotides containing an ester bond in the linker structure were cleaved by cellular esterases yielding oligonucleotides protected from 5'-nuclease degradation by the glycine residue. Antiviral activity of the derivatives exceeded that of the corresponding unmodified oligonucleotides. The virus suppression was sequence-specific and most pronounced in the case of the cholesteryl conjugated oligonucleotides.

c-fos gene expression in cell revertants from a transformed to a pseudonormal phenotype.

c-fos gene expression in two types of mouse sarcoma cells of spontaneous origin and in revertants to pseudonormal phenotype has been investigated. In the latter cells the content of c-fos mRNA is similar to that in normal fibroblasts. Activity of transcription factors interacting with the regulatory elements, SRE, DSE and TRE, in the c-fos promoter do not correlate with the c-fos mRNA concentration. However, experiments with cells transformed with the indicator plasmid, fos-CAT, showed that the 600 bp c-fos promoter region provides the chloramphenicol acetyltransferase activity correlating with c-fos mRNA expression in cell revertants to a pseudonormal phenotype.